Primer designing for genes responsible for hairy root induction (Theory)

4 Days Forward primer 5’CCTGCATTTCCAGAAACGAT3’ Reverse primer was 5’GAGTCGCAGGGTTAGGTCTG 3’

Time & Location

Reach us for more info on Timings

IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India

In this short course, we will cover the below items:

1. Basic concepts of primer designing

2. Selection of genes to check the integration of T-DNA in Transformed cultures

3. Explanation for how to design the primer