top of page

Primer designing for genes responsible for hairy root induction (Theory)

Reach us for more info on Timings

|

IBCTHYD

4 Days Forward primer 5’CCTGCATTTCCAGAAACGAT3’ Reverse primer was 5’GAGTCGCAGGGTTAGGTCTG 3’

Time & Location

Reach us for more info on Timings

IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India

About the Event

In this short course, we will cover the below items:

   1. Basic concepts of primer designing

    2. Selection of genes to check the integration of T-DNA in Transformed cultures

    3. Explanation for how to design the primer

Share This Event

  • Facebook
  • LinkedIn
  • Twitter

Institute of Bio-Chemical Technology Pvt Ltd

© Copyrights 2025 IBCTHYD, Inc. All rights reserved.

bottom of page