top of page

Online Teaching in Progress
Register Now!!

Gloriosine is Available

PLACEMENT’S!
For MSc Chemistry Final Year Students after Project Training 
About Us: Overview
Gradient

About Us

Welcome to the Institute of Bio-chemical Technology located in Nacharam, Hyderabad, India. Our Institute is Pioneer institute in training the students in latest technologies like Hairy root Induction Technology, Tissue culture and Natural Molecules enhancement through Genetic engineering.

  • The Institute also provides training in Natural product extraction, isolation, enhancement and testing

  • We offer consultancy services and short duration courses offline and online for the Hairy Root Induction technology and natural product isolation technology

  • We also undertake projects related to Bio active Molecules isolation and Enhancement from different medicinal plants. We have vast experience in the enhancement of Withanolides through Hairy Root Induction technology in Withania somnifera

Institute Head:

 

Dr. Madhavi. M.Sc., (Plant Science) M.sc (Chemistry)., B.Ed (Biology)., Ph.D (Genetics)

Excellent opportunity for UG, PG Graduates and Ph.D scholars to learn the Techniques, under the supervision of highly qualified Professionals holding Ph.D and above

Training Services

Unlocking the complexity and immense interconnections of the scientific mechanisms which dictate the properties  of the natural world is a major goal. To this end, we seek to acquire a detailed understanding of many systems and how these various systems function together to generate the observations and measurements from our experimentation. Have a look at some of our Training Services are:

  • GC Spectra analysis of Compounds extract (Theory)

  • Callus Initiation (Theory)

  • Complete Genetic Engineering of Withania somnifera (Ashwagandha) to enhance anticancer with anolides (Theory)

  • HPLC Spectra analysis of selected Bioactive Molecule targeted for enhancement (Training)

  • Basics and Spectral analysis method of 1 H NMR, IR and MASS spectra of medicinal compounds (Training)

  • Extraction of compounds from hairy roots and callus cultures (Training)

  • Detection of Genetically Transformed Cultures (Theory)

  • Method of hairy root and callus Induction of Medicinal plants (Theory)

  • Primer designing for genes responsible for hairy root induction (Theory)

  • Method of Discovery of Medicinal Compounds from plants (Theory)

  • Identification of Useful active molecules (Training)

  • TLC Profiling (Training)

  • Hairy root induction for enhancement of valuable Natural Compounds through Genetic Engineering

  • Enhancement of Medicinal Molecules Through Genetic Engineering

  • Growth media manipulations to enhance Bioactive molecules

  • Extraction of compound

  • Fractionation of Crude Extracts

  • Thin layer chromatography

  • Separation of compounds through Column Chromatography

  • Anti microbial activity testing of Bioactive Molecules

  • Fractionation of Eco friendly aromatic oils for herbal products

Gradient

Project Training

Gradient

Hairy root induction for enhancement of valuable Natural Compounds through Genetic Engineering

February 3, 2020

Project Training
Couses Offered
Gradient

Courses Offered

  • Detection of Genetically Transformed Cultures (Theory)
    Detection of Genetically Transformed Cultures (Theory)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    4 DAYS
  • Callus Initiation (Theory)
    Callus Initiation (Theory)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, Industrial Development Area, Nacharam, Secunderabad, Telangana 500076, India
    Reach us for more info on Timings
    IBCTHYD, Industrial Development Area, Nacharam, Secunderabad, Telangana 500076, India
    Course Duration: 7 Days
  • Complete Genetic Engineering of Withania somnifera (Ashwagandha) to enhance anticancer with anolides (Theory)
    Complete Genetic Engineering of Withania somnifera (Ashwagandha) to enhance anticancer with anolides (Theory)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 7 Days
  • GC Spectra analysis of Compounds extract (Theory)
    GC Spectra analysis of Compounds extract (Theory)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 4 Days
  • HPLC Spectra analysis of selected Bioactive Molecule targeted for enhancement (Training)
    HPLC Spectra analysis of selected Bioactive Molecule targeted for enhancement (Training)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 4 Days
  • Basics and Spectral analysis method of 1 H NMR, IR and MASS spectra of medicinal compounds (Training)
    Basics and Spectral analysis method of 1 H NMR, IR and MASS spectra of medicinal compounds (Training)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 7 Days
  • Extraction of compounds from hairy roots and callus cultures (Training)
    Extraction of compounds from hairy roots and callus cultures (Training)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 7 Days
  • Method of hairy root and callus Induction of Medicinal plants (Theory)
    Method of hairy root and callus Induction of Medicinal plants (Theory)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    7 Days
  • Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    4 Days Forward primer 5’CCTGCATTTCCAGAAACGAT3’ Reverse primer was 5’GAGTCGCAGGGTTAGGTCTG 3’
  • Method of Discovery of Medicinal Compounds from plants (Theory)
    Method of Discovery of Medicinal Compounds from plants (Theory)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 4 Days
  • Identification of Useful active molecules (Training)
    Identification of Useful active molecules (Training)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 5 Days
  • TLC Profiling (Training)
    TLC Profiling (Training)
    Reach us for more info on Timings
    IBCTHYD
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Reach us for more info on Timings
    IBCTHYD, 1/2B, IDA, Industrial Development Area, Nacharam, Secunderabad, Telangana 500051, India
    Course Duration: 7 Days

Contact Us

Institute of Bio-Chemical Technology, F-1/A, Opp to Economic Times, I.D.A, Nacharam, Hyderabad, India

Cell: 9493860154

Thanks for submitting! We will get back to you!

Contact Us
bottom of page